Journal: Nature structural & molecular biology

Article Title: Structural basis for the inhibition of PRC2 by active transcription histone posttranslational modifications.

doi: 10.1038/s41594-024-01452-x

Figure Lengend Snippet: Fig. 1 | Cryo-EM structures of PRC2AJ1–450 bound to H3K36me3-modified nucleosomes. a, Schematic representation of protein domains in the PRC2–AEBP2–JARID2 complex used in this work, containing either JARID21–450 or JARID2119. b, Representative methyltransferase assays performed on mononucleosome substrates that were either unmodified, H3K4me3 modified or H3K36me3 modified. Assays were repeated in triplicate with PRC2AJ1–450, PRC2AJ119–450 or PRC2AJ119–450 in the presence of 150 µM methylated JARID2 peptide including residues 107–121. c, Cryo-EM structure of PRC2AJ1–450 bound to an

Article Snippet: For use in both cryo-EM and EMSA experiments, human nucleosomes containing unmodified H3, H3K4me3 or H3K36me3 were purchased from Epicypher with biotinylated DNA containing the following sequence: G G AC C C TATAC G C G G C C G C C C TG G AG A ATC C C G G TC T GCAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTA A AC G C AC G TAC G C G C TG TC C C C C G C G T T T TA AC C G C C A A GGGGAT TACTCCCTAGTCTCCAGGCACGTGTCAGATATATAC ATCCTGTGCCGGTCGCGAACAGCGACC-3′ Human octamers lacking the H3 tail were purchased from The Histone Source and reconstituted into nucleosomes by standard protocols.

Techniques: Cryo-EM Sample Prep, Modification, Methylation

Journal: Nature structural & molecular biology

Article Title: Structural basis for the inhibition of PRC2 by active transcription histone posttranslational modifications.

doi: 10.1038/s41594-024-01452-x

Figure Lengend Snippet: Fig. 2 | Comparison of tail-engaged and tail-disengaged PRC22AJ1–450 complexes bound to H3K36me3-modified nucleosomes. a, Overlay of the cryo-EM density maps for the coexisting tail-engaged (blue) and tail-disengaged (green) PRC2AJ1–450–H3K36me3 structures identified by our analysis. Maps are aligned using the nucleosome to show the relative rotation of PRC2 on the nucleosome surface. b, Close-up view of the EZH2 bridge helix showing its

Article Snippet: For use in both cryo-EM and EMSA experiments, human nucleosomes containing unmodified H3, H3K4me3 or H3K36me3 were purchased from Epicypher with biotinylated DNA containing the following sequence: G G AC C C TATAC G C G G C C G C C C TG G AG A ATC C C G G TC T GCAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTA A AC G C AC G TAC G C G C TG TC C C C C G C G T T T TA AC C G C C A A GGGGAT TACTCCCTAGTCTCCAGGCACGTGTCAGATATATAC ATCCTGTGCCGGTCGCGAACAGCGACC-3′ Human octamers lacking the H3 tail were purchased from The Histone Source and reconstituted into nucleosomes by standard protocols.

Techniques: Comparison, Modification, Cryo-EM Sample Prep